ID: 946467181

View in Genome Browser
Species Human (GRCh38)
Location 2:219922337-219922359
Sequence ATATAGCCAAAGCTTTAGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946467179_946467181 23 Left 946467179 2:219922291-219922313 CCACTGGGCTTGTTTGCTGGGAT No data
Right 946467181 2:219922337-219922359 ATATAGCCAAAGCTTTAGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946467181 Original CRISPR ATATAGCCAAAGCTTTAGTG TGG Intergenic
No off target data available for this crispr