ID: 946469691

View in Genome Browser
Species Human (GRCh38)
Location 2:219947183-219947205
Sequence GGCAGGCATGAGAGTGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946469686_946469691 0 Left 946469686 2:219947160-219947182 CCTTCTACTTGAGAGTCCCACTT No data
Right 946469691 2:219947183-219947205 GGCAGGCATGAGAGTGAAAGTGG No data
946469684_946469691 15 Left 946469684 2:219947145-219947167 CCTTTCCTTTAAATTCCTTCTAC No data
Right 946469691 2:219947183-219947205 GGCAGGCATGAGAGTGAAAGTGG No data
946469685_946469691 10 Left 946469685 2:219947150-219947172 CCTTTAAATTCCTTCTACTTGAG No data
Right 946469691 2:219947183-219947205 GGCAGGCATGAGAGTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946469691 Original CRISPR GGCAGGCATGAGAGTGAAAG TGG Intergenic