ID: 946470723

View in Genome Browser
Species Human (GRCh38)
Location 2:219958097-219958119
Sequence TAACCACCGCCTGTGAATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946470717_946470723 26 Left 946470717 2:219958048-219958070 CCAAGAATGCTAAGGACTAAATA No data
Right 946470723 2:219958097-219958119 TAACCACCGCCTGTGAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946470723 Original CRISPR TAACCACCGCCTGTGAATTT GGG Intergenic
No off target data available for this crispr