ID: 946472356

View in Genome Browser
Species Human (GRCh38)
Location 2:219974018-219974040
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946472356_946472360 28 Left 946472356 2:219974018-219974040 CCATTTTCCTTCTGTATTTACTC No data
Right 946472360 2:219974069-219974091 TTTCAGATAGCATCTCAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946472356 Original CRISPR GAGTAAATACAGAAGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr