ID: 946477573

View in Genome Browser
Species Human (GRCh38)
Location 2:220023408-220023430
Sequence GGGTTGCCCTGGGCTAGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946477564_946477573 7 Left 946477564 2:220023378-220023400 CCACTCTTGTGTGTGTGTGCAGG No data
Right 946477573 2:220023408-220023430 GGGTTGCCCTGGGCTAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946477573 Original CRISPR GGGTTGCCCTGGGCTAGCCT AGG Intergenic
No off target data available for this crispr