ID: 946477962

View in Genome Browser
Species Human (GRCh38)
Location 2:220027316-220027338
Sequence CCAATCTGTGAATACAAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946477962_946477967 23 Left 946477962 2:220027316-220027338 CCAGCCTTGTATTCACAGATTGG No data
Right 946477967 2:220027362-220027384 GTACCTGTGCAAGATCACACAGG No data
946477962_946477969 30 Left 946477962 2:220027316-220027338 CCAGCCTTGTATTCACAGATTGG No data
Right 946477969 2:220027369-220027391 TGCAAGATCACACAGGAATTTGG No data
946477962_946477966 1 Left 946477962 2:220027316-220027338 CCAGCCTTGTATTCACAGATTGG No data
Right 946477966 2:220027340-220027362 AATTGAGGCTGAGAATGATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946477962 Original CRISPR CCAATCTGTGAATACAAGGC TGG (reversed) Intergenic
No off target data available for this crispr