ID: 946479292

View in Genome Browser
Species Human (GRCh38)
Location 2:220038492-220038514
Sequence CAAATTCCTGTATCATCCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946479292_946479294 20 Left 946479292 2:220038492-220038514 CCTAAGGATGATACAGGAATTTG No data
Right 946479294 2:220038535-220038557 TTTCTCTCTGAGATCTGTATTGG No data
946479292_946479295 21 Left 946479292 2:220038492-220038514 CCTAAGGATGATACAGGAATTTG No data
Right 946479295 2:220038536-220038558 TTCTCTCTGAGATCTGTATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946479292 Original CRISPR CAAATTCCTGTATCATCCTT AGG (reversed) Intergenic
No off target data available for this crispr