ID: 946479532

View in Genome Browser
Species Human (GRCh38)
Location 2:220040798-220040820
Sequence CAGGAGACCCAGAAGGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946479532_946479541 -2 Left 946479532 2:220040798-220040820 CCTTGCTCCTTCTGGGTCTCCTG No data
Right 946479541 2:220040819-220040841 TGTGGGGCTTTTCCTGGGTTGGG No data
946479532_946479540 -3 Left 946479532 2:220040798-220040820 CCTTGCTCCTTCTGGGTCTCCTG No data
Right 946479540 2:220040818-220040840 CTGTGGGGCTTTTCCTGGGTTGG No data
946479532_946479542 5 Left 946479532 2:220040798-220040820 CCTTGCTCCTTCTGGGTCTCCTG No data
Right 946479542 2:220040826-220040848 CTTTTCCTGGGTTGGGTCGCTGG No data
946479532_946479543 6 Left 946479532 2:220040798-220040820 CCTTGCTCCTTCTGGGTCTCCTG No data
Right 946479543 2:220040827-220040849 TTTTCCTGGGTTGGGTCGCTGGG No data
946479532_946479537 -8 Left 946479532 2:220040798-220040820 CCTTGCTCCTTCTGGGTCTCCTG No data
Right 946479537 2:220040813-220040835 GTCTCCTGTGGGGCTTTTCCTGG No data
946479532_946479545 22 Left 946479532 2:220040798-220040820 CCTTGCTCCTTCTGGGTCTCCTG No data
Right 946479545 2:220040843-220040865 CGCTGGGATTTGCCAAATCCTGG No data
946479532_946479538 -7 Left 946479532 2:220040798-220040820 CCTTGCTCCTTCTGGGTCTCCTG No data
Right 946479538 2:220040814-220040836 TCTCCTGTGGGGCTTTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946479532 Original CRISPR CAGGAGACCCAGAAGGAGCA AGG (reversed) Intergenic
No off target data available for this crispr