ID: 946480803

View in Genome Browser
Species Human (GRCh38)
Location 2:220054891-220054913
Sequence GGCTTCTTTGTAGCTTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946480803_946480811 7 Left 946480803 2:220054891-220054913 CCCAGTGAAGCTACAAAGAAGCC No data
Right 946480811 2:220054921-220054943 CTTTGGTTCTAAAGCCGGGTGGG No data
946480803_946480813 9 Left 946480803 2:220054891-220054913 CCCAGTGAAGCTACAAAGAAGCC No data
Right 946480813 2:220054923-220054945 TTGGTTCTAAAGCCGGGTGGGGG No data
946480803_946480806 -10 Left 946480803 2:220054891-220054913 CCCAGTGAAGCTACAAAGAAGCC No data
Right 946480806 2:220054904-220054926 CAAAGAAGCCAGGAACACTTTGG No data
946480803_946480810 6 Left 946480803 2:220054891-220054913 CCCAGTGAAGCTACAAAGAAGCC No data
Right 946480810 2:220054920-220054942 ACTTTGGTTCTAAAGCCGGGTGG No data
946480803_946480812 8 Left 946480803 2:220054891-220054913 CCCAGTGAAGCTACAAAGAAGCC No data
Right 946480812 2:220054922-220054944 TTTGGTTCTAAAGCCGGGTGGGG No data
946480803_946480808 2 Left 946480803 2:220054891-220054913 CCCAGTGAAGCTACAAAGAAGCC No data
Right 946480808 2:220054916-220054938 GAACACTTTGGTTCTAAAGCCGG No data
946480803_946480809 3 Left 946480803 2:220054891-220054913 CCCAGTGAAGCTACAAAGAAGCC No data
Right 946480809 2:220054917-220054939 AACACTTTGGTTCTAAAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946480803 Original CRISPR GGCTTCTTTGTAGCTTCACT GGG (reversed) Intergenic