ID: 946480804

View in Genome Browser
Species Human (GRCh38)
Location 2:220054892-220054914
Sequence TGGCTTCTTTGTAGCTTCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946480804_946480811 6 Left 946480804 2:220054892-220054914 CCAGTGAAGCTACAAAGAAGCCA No data
Right 946480811 2:220054921-220054943 CTTTGGTTCTAAAGCCGGGTGGG No data
946480804_946480810 5 Left 946480804 2:220054892-220054914 CCAGTGAAGCTACAAAGAAGCCA No data
Right 946480810 2:220054920-220054942 ACTTTGGTTCTAAAGCCGGGTGG No data
946480804_946480813 8 Left 946480804 2:220054892-220054914 CCAGTGAAGCTACAAAGAAGCCA No data
Right 946480813 2:220054923-220054945 TTGGTTCTAAAGCCGGGTGGGGG No data
946480804_946480809 2 Left 946480804 2:220054892-220054914 CCAGTGAAGCTACAAAGAAGCCA No data
Right 946480809 2:220054917-220054939 AACACTTTGGTTCTAAAGCCGGG No data
946480804_946480808 1 Left 946480804 2:220054892-220054914 CCAGTGAAGCTACAAAGAAGCCA No data
Right 946480808 2:220054916-220054938 GAACACTTTGGTTCTAAAGCCGG No data
946480804_946480812 7 Left 946480804 2:220054892-220054914 CCAGTGAAGCTACAAAGAAGCCA No data
Right 946480812 2:220054922-220054944 TTTGGTTCTAAAGCCGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946480804 Original CRISPR TGGCTTCTTTGTAGCTTCAC TGG (reversed) Intergenic