ID: 946480813

View in Genome Browser
Species Human (GRCh38)
Location 2:220054923-220054945
Sequence TTGGTTCTAAAGCCGGGTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946480804_946480813 8 Left 946480804 2:220054892-220054914 CCAGTGAAGCTACAAAGAAGCCA No data
Right 946480813 2:220054923-220054945 TTGGTTCTAAAGCCGGGTGGGGG No data
946480803_946480813 9 Left 946480803 2:220054891-220054913 CCCAGTGAAGCTACAAAGAAGCC No data
Right 946480813 2:220054923-220054945 TTGGTTCTAAAGCCGGGTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946480813 Original CRISPR TTGGTTCTAAAGCCGGGTGG GGG Intergenic