ID: 946481282

View in Genome Browser
Species Human (GRCh38)
Location 2:220059220-220059242
Sequence CCTCCTCAGCACCTGTAGCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946481277_946481282 15 Left 946481277 2:220059182-220059204 CCTCTGGCTCCTGGGTTTGAGCA No data
Right 946481282 2:220059220-220059242 CCTCCTCAGCACCTGTAGCTAGG No data
946481278_946481282 6 Left 946481278 2:220059191-220059213 CCTGGGTTTGAGCAATTTTCCTG 0: 6
1: 170
2: 2773
3: 40856
4: 115965
Right 946481282 2:220059220-220059242 CCTCCTCAGCACCTGTAGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946481282 Original CRISPR CCTCCTCAGCACCTGTAGCT AGG Intergenic
No off target data available for this crispr