ID: 946483145

View in Genome Browser
Species Human (GRCh38)
Location 2:220075695-220075717
Sequence CACAGAAGTTGGCCTGGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946483145_946483157 23 Left 946483145 2:220075695-220075717 CCTGTCCCAGGCCAACTTCTGTG No data
Right 946483157 2:220075741-220075763 GTAAAAGTCAAATGTCACATGGG No data
946483145_946483160 28 Left 946483145 2:220075695-220075717 CCTGTCCCAGGCCAACTTCTGTG No data
Right 946483160 2:220075746-220075768 AGTCAAATGTCACATGGGGGTGG No data
946483145_946483151 -2 Left 946483145 2:220075695-220075717 CCTGTCCCAGGCCAACTTCTGTG No data
Right 946483151 2:220075716-220075738 TGGCTCCCTGGTGCCCTGAGTGG No data
946483145_946483156 22 Left 946483145 2:220075695-220075717 CCTGTCCCAGGCCAACTTCTGTG No data
Right 946483156 2:220075740-220075762 AGTAAAAGTCAAATGTCACATGG No data
946483145_946483161 29 Left 946483145 2:220075695-220075717 CCTGTCCCAGGCCAACTTCTGTG No data
Right 946483161 2:220075747-220075769 GTCAAATGTCACATGGGGGTGGG No data
946483145_946483162 30 Left 946483145 2:220075695-220075717 CCTGTCCCAGGCCAACTTCTGTG No data
Right 946483162 2:220075748-220075770 TCAAATGTCACATGGGGGTGGGG No data
946483145_946483158 24 Left 946483145 2:220075695-220075717 CCTGTCCCAGGCCAACTTCTGTG No data
Right 946483158 2:220075742-220075764 TAAAAGTCAAATGTCACATGGGG No data
946483145_946483159 25 Left 946483145 2:220075695-220075717 CCTGTCCCAGGCCAACTTCTGTG No data
Right 946483159 2:220075743-220075765 AAAAGTCAAATGTCACATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946483145 Original CRISPR CACAGAAGTTGGCCTGGGAC AGG (reversed) Intergenic
No off target data available for this crispr