ID: 946484633

View in Genome Browser
Species Human (GRCh38)
Location 2:220089200-220089222
Sequence TACCAGGAGCACTGCAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946484633_946484640 17 Left 946484633 2:220089200-220089222 CCTCATCTGCAGTGCTCCTGGTA No data
Right 946484640 2:220089240-220089262 TCTGCCTCTGAGGTTATTTTTGG No data
946484633_946484638 7 Left 946484633 2:220089200-220089222 CCTCATCTGCAGTGCTCCTGGTA No data
Right 946484638 2:220089230-220089252 CTCCTTTCTCTCTGCCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946484633 Original CRISPR TACCAGGAGCACTGCAGATG AGG (reversed) Intergenic
No off target data available for this crispr