ID: 946494265

View in Genome Browser
Species Human (GRCh38)
Location 2:220179802-220179824
Sequence GTGCATTCAAGGATCAATGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946494261_946494265 6 Left 946494261 2:220179773-220179795 CCCAATTTTTGCTTAAACTGATC No data
Right 946494265 2:220179802-220179824 GTGCATTCAAGGATCAATGTGGG No data
946494262_946494265 5 Left 946494262 2:220179774-220179796 CCAATTTTTGCTTAAACTGATCT No data
Right 946494265 2:220179802-220179824 GTGCATTCAAGGATCAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946494265 Original CRISPR GTGCATTCAAGGATCAATGT GGG Intergenic
No off target data available for this crispr