ID: 946497196

View in Genome Browser
Species Human (GRCh38)
Location 2:220206396-220206418
Sequence TTGGGAATTCTGAATGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946497190_946497196 10 Left 946497190 2:220206363-220206385 CCTCTTCCTCCTTGATATAACCT No data
Right 946497196 2:220206396-220206418 TTGGGAATTCTGAATGAGAAAGG No data
946497195_946497196 -10 Left 946497195 2:220206383-220206405 CCTCTCTTAGACTTTGGGAATTC No data
Right 946497196 2:220206396-220206418 TTGGGAATTCTGAATGAGAAAGG No data
946497192_946497196 1 Left 946497192 2:220206372-220206394 CCTTGATATAACCTCTCTTAGAC No data
Right 946497196 2:220206396-220206418 TTGGGAATTCTGAATGAGAAAGG No data
946497191_946497196 4 Left 946497191 2:220206369-220206391 CCTCCTTGATATAACCTCTCTTA No data
Right 946497196 2:220206396-220206418 TTGGGAATTCTGAATGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946497196 Original CRISPR TTGGGAATTCTGAATGAGAA AGG Intergenic
No off target data available for this crispr