ID: 946498497 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:220220341-220220363 |
| Sequence | GTTCCATCTTTCCACTTTCA AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 946498497_946498500 | -8 | Left | 946498497 | 2:220220341-220220363 | CCTTGAAAGTGGAAAGATGGAAC | No data | ||
| Right | 946498500 | 2:220220356-220220378 | GATGGAACCCTGGGAAGAGAAGG | No data | ||||
| 946498497_946498503 | 16 | Left | 946498497 | 2:220220341-220220363 | CCTTGAAAGTGGAAAGATGGAAC | No data | ||
| Right | 946498503 | 2:220220380-220220402 | GTTCTAGTGATCTAAACCATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 946498497 | Original CRISPR | GTTCCATCTTTCCACTTTCA AGG (reversed) | Intergenic | ||