ID: 946498497

View in Genome Browser
Species Human (GRCh38)
Location 2:220220341-220220363
Sequence GTTCCATCTTTCCACTTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946498497_946498503 16 Left 946498497 2:220220341-220220363 CCTTGAAAGTGGAAAGATGGAAC No data
Right 946498503 2:220220380-220220402 GTTCTAGTGATCTAAACCATAGG No data
946498497_946498500 -8 Left 946498497 2:220220341-220220363 CCTTGAAAGTGGAAAGATGGAAC No data
Right 946498500 2:220220356-220220378 GATGGAACCCTGGGAAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946498497 Original CRISPR GTTCCATCTTTCCACTTTCA AGG (reversed) Intergenic