ID: 946498500

View in Genome Browser
Species Human (GRCh38)
Location 2:220220356-220220378
Sequence GATGGAACCCTGGGAAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946498497_946498500 -8 Left 946498497 2:220220341-220220363 CCTTGAAAGTGGAAAGATGGAAC No data
Right 946498500 2:220220356-220220378 GATGGAACCCTGGGAAGAGAAGG No data
946498494_946498500 9 Left 946498494 2:220220324-220220346 CCTACAGGAAGCACTTTCCTTGA No data
Right 946498500 2:220220356-220220378 GATGGAACCCTGGGAAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946498500 Original CRISPR GATGGAACCCTGGGAAGAGA AGG Intergenic
No off target data available for this crispr