ID: 946498501 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:220220363-220220385 |
Sequence | TAGAACTCCTTCTCTTCCCA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
946498501_946498506 | 10 | Left | 946498501 | 2:220220363-220220385 | CCCTGGGAAGAGAAGGAGTTCTA | No data | ||
Right | 946498506 | 2:220220396-220220418 | CCATAGGTAATGCTGCTTATGGG | No data | ||||
946498501_946498504 | 9 | Left | 946498501 | 2:220220363-220220385 | CCCTGGGAAGAGAAGGAGTTCTA | No data | ||
Right | 946498504 | 2:220220395-220220417 | ACCATAGGTAATGCTGCTTATGG | No data | ||||
946498501_946498503 | -6 | Left | 946498501 | 2:220220363-220220385 | CCCTGGGAAGAGAAGGAGTTCTA | No data | ||
Right | 946498503 | 2:220220380-220220402 | GTTCTAGTGATCTAAACCATAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
946498501 | Original CRISPR | TAGAACTCCTTCTCTTCCCA GGG (reversed) | Intergenic | ||