ID: 946498501

View in Genome Browser
Species Human (GRCh38)
Location 2:220220363-220220385
Sequence TAGAACTCCTTCTCTTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946498501_946498506 10 Left 946498501 2:220220363-220220385 CCCTGGGAAGAGAAGGAGTTCTA No data
Right 946498506 2:220220396-220220418 CCATAGGTAATGCTGCTTATGGG No data
946498501_946498504 9 Left 946498501 2:220220363-220220385 CCCTGGGAAGAGAAGGAGTTCTA No data
Right 946498504 2:220220395-220220417 ACCATAGGTAATGCTGCTTATGG No data
946498501_946498503 -6 Left 946498501 2:220220363-220220385 CCCTGGGAAGAGAAGGAGTTCTA No data
Right 946498503 2:220220380-220220402 GTTCTAGTGATCTAAACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946498501 Original CRISPR TAGAACTCCTTCTCTTCCCA GGG (reversed) Intergenic