ID: 946498503

View in Genome Browser
Species Human (GRCh38)
Location 2:220220380-220220402
Sequence GTTCTAGTGATCTAAACCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946498497_946498503 16 Left 946498497 2:220220341-220220363 CCTTGAAAGTGGAAAGATGGAAC No data
Right 946498503 2:220220380-220220402 GTTCTAGTGATCTAAACCATAGG No data
946498501_946498503 -6 Left 946498501 2:220220363-220220385 CCCTGGGAAGAGAAGGAGTTCTA No data
Right 946498503 2:220220380-220220402 GTTCTAGTGATCTAAACCATAGG No data
946498502_946498503 -7 Left 946498502 2:220220364-220220386 CCTGGGAAGAGAAGGAGTTCTAG No data
Right 946498503 2:220220380-220220402 GTTCTAGTGATCTAAACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946498503 Original CRISPR GTTCTAGTGATCTAAACCAT AGG Intergenic