ID: 946500169

View in Genome Browser
Species Human (GRCh38)
Location 2:220238724-220238746
Sequence TGGGTTATTTAGGAAGTTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946500163_946500169 5 Left 946500163 2:220238696-220238718 CCTTGGTATTCCACCAGAGAACT No data
Right 946500169 2:220238724-220238746 TGGGTTATTTAGGAAGTTGCTGG No data
946500166_946500169 -5 Left 946500166 2:220238706-220238728 CCACCAGAGAACTTTCACTGGGT No data
Right 946500169 2:220238724-220238746 TGGGTTATTTAGGAAGTTGCTGG No data
946500167_946500169 -8 Left 946500167 2:220238709-220238731 CCAGAGAACTTTCACTGGGTTAT No data
Right 946500169 2:220238724-220238746 TGGGTTATTTAGGAAGTTGCTGG No data
946500162_946500169 21 Left 946500162 2:220238680-220238702 CCTTAAATGAGCAGGGCCTTGGT No data
Right 946500169 2:220238724-220238746 TGGGTTATTTAGGAAGTTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946500169 Original CRISPR TGGGTTATTTAGGAAGTTGC TGG Intergenic
No off target data available for this crispr