ID: 946500173

View in Genome Browser
Species Human (GRCh38)
Location 2:220238749-220238771
Sequence TCTAGTGTGGTAGAAGCCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946500173_946500179 16 Left 946500173 2:220238749-220238771 CCTTTGGCTTCTACCACACTAGA No data
Right 946500179 2:220238788-220238810 CTGGCTTTGGACTCAGGTGCTGG No data
946500173_946500177 3 Left 946500173 2:220238749-220238771 CCTTTGGCTTCTACCACACTAGA No data
Right 946500177 2:220238775-220238797 AGCAGAAGGATAACTGGCTTTGG No data
946500173_946500180 20 Left 946500173 2:220238749-220238771 CCTTTGGCTTCTACCACACTAGA No data
Right 946500180 2:220238792-220238814 CTTTGGACTCAGGTGCTGGCTGG No data
946500173_946500176 -3 Left 946500173 2:220238749-220238771 CCTTTGGCTTCTACCACACTAGA No data
Right 946500176 2:220238769-220238791 AGATGAAGCAGAAGGATAACTGG No data
946500173_946500178 10 Left 946500173 2:220238749-220238771 CCTTTGGCTTCTACCACACTAGA No data
Right 946500178 2:220238782-220238804 GGATAACTGGCTTTGGACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946500173 Original CRISPR TCTAGTGTGGTAGAAGCCAA AGG (reversed) Intergenic
No off target data available for this crispr