ID: 946500175

View in Genome Browser
Species Human (GRCh38)
Location 2:220238762-220238784
Sequence TCCTTCTGCTTCATCTAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946500175_946500178 -3 Left 946500175 2:220238762-220238784 CCACACTAGATGAAGCAGAAGGA No data
Right 946500178 2:220238782-220238804 GGATAACTGGCTTTGGACTCAGG No data
946500175_946500177 -10 Left 946500175 2:220238762-220238784 CCACACTAGATGAAGCAGAAGGA No data
Right 946500177 2:220238775-220238797 AGCAGAAGGATAACTGGCTTTGG No data
946500175_946500179 3 Left 946500175 2:220238762-220238784 CCACACTAGATGAAGCAGAAGGA No data
Right 946500179 2:220238788-220238810 CTGGCTTTGGACTCAGGTGCTGG No data
946500175_946500180 7 Left 946500175 2:220238762-220238784 CCACACTAGATGAAGCAGAAGGA No data
Right 946500180 2:220238792-220238814 CTTTGGACTCAGGTGCTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946500175 Original CRISPR TCCTTCTGCTTCATCTAGTG TGG (reversed) Intergenic
No off target data available for this crispr