ID: 946500179

View in Genome Browser
Species Human (GRCh38)
Location 2:220238788-220238810
Sequence CTGGCTTTGGACTCAGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946500175_946500179 3 Left 946500175 2:220238762-220238784 CCACACTAGATGAAGCAGAAGGA No data
Right 946500179 2:220238788-220238810 CTGGCTTTGGACTCAGGTGCTGG No data
946500173_946500179 16 Left 946500173 2:220238749-220238771 CCTTTGGCTTCTACCACACTAGA No data
Right 946500179 2:220238788-220238810 CTGGCTTTGGACTCAGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946500179 Original CRISPR CTGGCTTTGGACTCAGGTGC TGG Intergenic
No off target data available for this crispr