ID: 946505935

View in Genome Browser
Species Human (GRCh38)
Location 2:220300838-220300860
Sequence TTGCATTAGGTCCTAGGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946505930_946505935 28 Left 946505930 2:220300787-220300809 CCAAAAAGAAAAGGGATAAAGAA No data
Right 946505935 2:220300838-220300860 TTGCATTAGGTCCTAGGGAAAGG No data
946505929_946505935 29 Left 946505929 2:220300786-220300808 CCCAAAAAGAAAAGGGATAAAGA No data
Right 946505935 2:220300838-220300860 TTGCATTAGGTCCTAGGGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946505935 Original CRISPR TTGCATTAGGTCCTAGGGAA AGG Intergenic
No off target data available for this crispr