ID: 946506942

View in Genome Browser
Species Human (GRCh38)
Location 2:220311961-220311983
Sequence GTGGAGGACTGGACAGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946506942_946506952 21 Left 946506942 2:220311961-220311983 CCGTCCTCTGTCCAGTCCTCCAC No data
Right 946506952 2:220312005-220312027 TTTTAACAACTCTGTGCTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946506942 Original CRISPR GTGGAGGACTGGACAGAGGA CGG (reversed) Intergenic
No off target data available for this crispr