ID: 946509154

View in Genome Browser
Species Human (GRCh38)
Location 2:220335444-220335466
Sequence GGACCTAATGAAACACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946509154_946509156 -2 Left 946509154 2:220335444-220335466 CCAGCTGGTGTTTCATTAGGTCC No data
Right 946509156 2:220335465-220335487 CCTGTGCTCCCCAAGTCTGTTGG No data
946509154_946509160 22 Left 946509154 2:220335444-220335466 CCAGCTGGTGTTTCATTAGGTCC No data
Right 946509160 2:220335489-220335511 TCTGAGCCCAGCACAGCACCAGG 0: 24
1: 85
2: 154
3: 376
4: 1252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946509154 Original CRISPR GGACCTAATGAAACACCAGC TGG (reversed) Intergenic
No off target data available for this crispr