ID: 946511826

View in Genome Browser
Species Human (GRCh38)
Location 2:220366290-220366312
Sequence TTGGCTAAGGGCCATCATCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946511826_946511834 5 Left 946511826 2:220366290-220366312 CCCAGATGATGGCCCTTAGCCAA No data
Right 946511834 2:220366318-220366340 GCTAGGGATGTGGCTTTGAAAGG No data
946511826_946511832 -5 Left 946511826 2:220366290-220366312 CCCAGATGATGGCCCTTAGCCAA No data
Right 946511832 2:220366308-220366330 GCCAATAACTGCTAGGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946511826 Original CRISPR TTGGCTAAGGGCCATCATCT GGG (reversed) Intergenic
No off target data available for this crispr