ID: 946511999

View in Genome Browser
Species Human (GRCh38)
Location 2:220367911-220367933
Sequence AGGATGAAAAAGTCTGATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946511999_946512002 14 Left 946511999 2:220367911-220367933 CCATAATCAGACTTTTTCATCCT No data
Right 946512002 2:220367948-220367970 AGTTTGTGAAGAGCACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946511999 Original CRISPR AGGATGAAAAAGTCTGATTA TGG (reversed) Intergenic
No off target data available for this crispr