ID: 946512219

View in Genome Browser
Species Human (GRCh38)
Location 2:220370379-220370401
Sequence CAGTGCAGGTGGTGAGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946512219_946512226 24 Left 946512219 2:220370379-220370401 CCCACTTCTCACCACCTGCACTG No data
Right 946512226 2:220370426-220370448 TCATCTGAGATCTGGATCACTGG No data
946512219_946512224 16 Left 946512219 2:220370379-220370401 CCCACTTCTCACCACCTGCACTG No data
Right 946512224 2:220370418-220370440 AGCTACCATCATCTGAGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946512219 Original CRISPR CAGTGCAGGTGGTGAGAAGT GGG (reversed) Intergenic
No off target data available for this crispr