ID: 946512442

View in Genome Browser
Species Human (GRCh38)
Location 2:220373461-220373483
Sequence TAAAAAGTATAAAAAGTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946512442_946512448 4 Left 946512442 2:220373461-220373483 CCCCCCACTTTTTATACTTTTTA No data
Right 946512448 2:220373488-220373510 CAAAATGATTCGGTCTTGTATGG No data
946512442_946512447 -6 Left 946512442 2:220373461-220373483 CCCCCCACTTTTTATACTTTTTA No data
Right 946512447 2:220373478-220373500 TTTTTAAAGACAAAATGATTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946512442 Original CRISPR TAAAAAGTATAAAAAGTGGG GGG (reversed) Intergenic
No off target data available for this crispr