ID: 946521267

View in Genome Browser
Species Human (GRCh38)
Location 2:220467567-220467589
Sequence GTGGAGATGATGAATGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946521263_946521267 -8 Left 946521263 2:220467552-220467574 CCCAGTAAGTCACCAGTGGAGAT No data
Right 946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG No data
946521264_946521267 -9 Left 946521264 2:220467553-220467575 CCAGTAAGTCACCAGTGGAGATG No data
Right 946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG No data
946521261_946521267 1 Left 946521261 2:220467543-220467565 CCTGTCTCACCCAGTAAGTCACC No data
Right 946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG No data
946521260_946521267 25 Left 946521260 2:220467519-220467541 CCTGTGTCTGTATTAATGGCTTC No data
Right 946521267 2:220467567-220467589 GTGGAGATGATGAATGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946521267 Original CRISPR GTGGAGATGATGAATGAGCA GGG Intergenic
No off target data available for this crispr