ID: 946521432

View in Genome Browser
Species Human (GRCh38)
Location 2:220468979-220469001
Sequence AAGTTCCACCACAACTAGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946521426_946521432 28 Left 946521426 2:220468928-220468950 CCAGGACACAAGGCAAAACACAG No data
Right 946521432 2:220468979-220469001 AAGTTCCACCACAACTAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946521432 Original CRISPR AAGTTCCACCACAACTAGTG AGG Intergenic
No off target data available for this crispr