ID: 946523713

View in Genome Browser
Species Human (GRCh38)
Location 2:220495246-220495268
Sequence ATTGTATTCAGTGGCATCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946523711_946523713 12 Left 946523711 2:220495211-220495233 CCTTCTTTGAGGTCTATAAAAAT No data
Right 946523713 2:220495246-220495268 ATTGTATTCAGTGGCATCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946523713 Original CRISPR ATTGTATTCAGTGGCATCAC TGG Intergenic
No off target data available for this crispr