ID: 946527867

View in Genome Browser
Species Human (GRCh38)
Location 2:220539958-220539980
Sequence GACAGCTCTTGGCCCGTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946527867_946527872 16 Left 946527867 2:220539958-220539980 CCAGTAACGGGCCAAGAGCTGTC No data
Right 946527872 2:220539997-220540019 GTTATCTGCAGAAGATGGCAGGG 0: 180
1: 172
2: 120
3: 86
4: 284
946527867_946527870 11 Left 946527867 2:220539958-220539980 CCAGTAACGGGCCAAGAGCTGTC No data
Right 946527870 2:220539992-220540014 AAATAGTTATCTGCAGAAGATGG No data
946527867_946527871 15 Left 946527867 2:220539958-220539980 CCAGTAACGGGCCAAGAGCTGTC No data
Right 946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG 0: 185
1: 187
2: 104
3: 111
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946527867 Original CRISPR GACAGCTCTTGGCCCGTTAC TGG (reversed) Intergenic
No off target data available for this crispr