ID: 946528533

View in Genome Browser
Species Human (GRCh38)
Location 2:220546585-220546607
Sequence AAGGAGAAGAAGAAAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946528533_946528536 9 Left 946528533 2:220546585-220546607 CCTTCTTCTTTCTTCTTCTCCTT No data
Right 946528536 2:220546617-220546639 TCTCCAGCAGAGTTATCTCTGGG No data
946528533_946528539 22 Left 946528533 2:220546585-220546607 CCTTCTTCTTTCTTCTTCTCCTT No data
Right 946528539 2:220546630-220546652 TATCTCTGGGCAAAAGTGGAAGG No data
946528533_946528538 18 Left 946528533 2:220546585-220546607 CCTTCTTCTTTCTTCTTCTCCTT No data
Right 946528538 2:220546626-220546648 GAGTTATCTCTGGGCAAAAGTGG No data
946528533_946528535 8 Left 946528533 2:220546585-220546607 CCTTCTTCTTTCTTCTTCTCCTT No data
Right 946528535 2:220546616-220546638 TTCTCCAGCAGAGTTATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946528533 Original CRISPR AAGGAGAAGAAGAAAGAAGA AGG (reversed) Intergenic
No off target data available for this crispr