ID: 946534858

View in Genome Browser
Species Human (GRCh38)
Location 2:220615924-220615946
Sequence CTGTATGAGGGGAATGAGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946534858_946534863 21 Left 946534858 2:220615924-220615946 CCAGTCTCATTCCCCTCATACAG No data
Right 946534863 2:220615968-220615990 TGATAAATGTCACTGAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946534858 Original CRISPR CTGTATGAGGGGAATGAGAC TGG (reversed) Intergenic
No off target data available for this crispr