ID: 946535140

View in Genome Browser
Species Human (GRCh38)
Location 2:220619584-220619606
Sequence TAGAGCTGCAACTCTCAAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946535137_946535140 13 Left 946535137 2:220619548-220619570 CCTAGGCTCTGGAAGAGACGAAC No data
Right 946535140 2:220619584-220619606 TAGAGCTGCAACTCTCAAGTTGG No data
946535138_946535140 -9 Left 946535138 2:220619570-220619592 CCTGCCAAGCTGTCTAGAGCTGC No data
Right 946535140 2:220619584-220619606 TAGAGCTGCAACTCTCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946535140 Original CRISPR TAGAGCTGCAACTCTCAAGT TGG Intergenic
No off target data available for this crispr