ID: 946540586

View in Genome Browser
Species Human (GRCh38)
Location 2:220680248-220680270
Sequence CAGAATAAGAAGTTGTATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946540586_946540588 -10 Left 946540586 2:220680248-220680270 CCTAAATACAACTTCTTATTCTG No data
Right 946540588 2:220680261-220680283 TCTTATTCTGCTCTCCCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946540586 Original CRISPR CAGAATAAGAAGTTGTATTT AGG (reversed) Intergenic
No off target data available for this crispr