ID: 946542399

View in Genome Browser
Species Human (GRCh38)
Location 2:220699006-220699028
Sequence CTCATCAGTGCTGTGTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946542399_946542403 1 Left 946542399 2:220699006-220699028 CCTCCTGACACAGCACTGATGAG No data
Right 946542403 2:220699030-220699052 AGGCCTTCCTGCTCTTGTTTGGG No data
946542399_946542402 0 Left 946542399 2:220699006-220699028 CCTCCTGACACAGCACTGATGAG No data
Right 946542402 2:220699029-220699051 AAGGCCTTCCTGCTCTTGTTTGG No data
946542399_946542406 17 Left 946542399 2:220699006-220699028 CCTCCTGACACAGCACTGATGAG No data
Right 946542406 2:220699046-220699068 GTTTGGGTTCCATATTTTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946542399 Original CRISPR CTCATCAGTGCTGTGTCAGG AGG (reversed) Intergenic
No off target data available for this crispr