ID: 946545612

View in Genome Browser
Species Human (GRCh38)
Location 2:220739424-220739446
Sequence CTGTGATTCGTGAGCTACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946545609_946545612 6 Left 946545609 2:220739395-220739417 CCTGTACATCAATTAGTGAGAAC No data
Right 946545612 2:220739424-220739446 CTGTGATTCGTGAGCTACCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946545612 Original CRISPR CTGTGATTCGTGAGCTACCA GGG Intergenic
No off target data available for this crispr