ID: 946547128

View in Genome Browser
Species Human (GRCh38)
Location 2:220756456-220756478
Sequence GGTCAGAGCACACCCCATGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946547119_946547128 14 Left 946547119 2:220756419-220756441 CCTTAGCTGTGAAAGCAGGGAGG No data
Right 946547128 2:220756456-220756478 GGTCAGAGCACACCCCATGCGGG No data
946547117_946547128 16 Left 946547117 2:220756417-220756439 CCCCTTAGCTGTGAAAGCAGGGA No data
Right 946547128 2:220756456-220756478 GGTCAGAGCACACCCCATGCGGG No data
946547113_946547128 24 Left 946547113 2:220756409-220756431 CCTCTCCTCCCCTTAGCTGTGAA No data
Right 946547128 2:220756456-220756478 GGTCAGAGCACACCCCATGCGGG No data
946547118_946547128 15 Left 946547118 2:220756418-220756440 CCCTTAGCTGTGAAAGCAGGGAG No data
Right 946547128 2:220756456-220756478 GGTCAGAGCACACCCCATGCGGG No data
946547114_946547128 19 Left 946547114 2:220756414-220756436 CCTCCCCTTAGCTGTGAAAGCAG No data
Right 946547128 2:220756456-220756478 GGTCAGAGCACACCCCATGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946547128 Original CRISPR GGTCAGAGCACACCCCATGC GGG Intergenic
No off target data available for this crispr