ID: 946562161

View in Genome Browser
Species Human (GRCh38)
Location 2:220925936-220925958
Sequence CACAAGGATGGAACTGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946562161_946562171 22 Left 946562161 2:220925936-220925958 CCTTGGGCAGTTCCATCCTTGTG No data
Right 946562171 2:220925981-220926003 TCCTTGCTGCTTTCATGGCCTGG No data
946562161_946562170 17 Left 946562161 2:220925936-220925958 CCTTGGGCAGTTCCATCCTTGTG No data
Right 946562170 2:220925976-220925998 CCTTTTCCTTGCTGCTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946562161 Original CRISPR CACAAGGATGGAACTGCCCA AGG (reversed) Intergenic
No off target data available for this crispr