ID: 946562937

View in Genome Browser
Species Human (GRCh38)
Location 2:220933582-220933604
Sequence GAGTGAAACCATAAGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946562937_946562943 20 Left 946562937 2:220933582-220933604 CCCACATCCTTATGGTTTCACTC No data
Right 946562943 2:220933625-220933647 CTCTCTGCCCGGAAGACTGCTGG No data
946562937_946562941 9 Left 946562937 2:220933582-220933604 CCCACATCCTTATGGTTTCACTC No data
Right 946562941 2:220933614-220933636 TCCATAGGTCACTCTCTGCCCGG No data
946562937_946562940 -6 Left 946562937 2:220933582-220933604 CCCACATCCTTATGGTTTCACTC No data
Right 946562940 2:220933599-220933621 TCACTCGCAAATTTCTCCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946562937 Original CRISPR GAGTGAAACCATAAGGATGT GGG (reversed) Intergenic
No off target data available for this crispr