ID: 946569600

View in Genome Browser
Species Human (GRCh38)
Location 2:221008837-221008859
Sequence GGGTCAAGGAACCACTATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946569596_946569600 20 Left 946569596 2:221008794-221008816 CCACAAGCAAAATAAAAAATATA No data
Right 946569600 2:221008837-221008859 GGGTCAAGGAACCACTATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946569600 Original CRISPR GGGTCAAGGAACCACTATAC AGG Intergenic
No off target data available for this crispr