ID: 946581524

View in Genome Browser
Species Human (GRCh38)
Location 2:221133390-221133412
Sequence TTACCTCTGTCTAGGTTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946581522_946581524 -7 Left 946581522 2:221133374-221133396 CCACAGTGTCATATAATTACCTC No data
Right 946581524 2:221133390-221133412 TTACCTCTGTCTAGGTTGTCAGG No data
946581521_946581524 0 Left 946581521 2:221133367-221133389 CCTGTAACCACAGTGTCATATAA No data
Right 946581524 2:221133390-221133412 TTACCTCTGTCTAGGTTGTCAGG No data
946581520_946581524 11 Left 946581520 2:221133356-221133378 CCTGCTCTAATCCTGTAACCACA No data
Right 946581524 2:221133390-221133412 TTACCTCTGTCTAGGTTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946581524 Original CRISPR TTACCTCTGTCTAGGTTGTC AGG Intergenic
No off target data available for this crispr