ID: 946584171

View in Genome Browser
Species Human (GRCh38)
Location 2:221165461-221165483
Sequence CTGGTCTTGGGATCTGTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946584162_946584171 25 Left 946584162 2:221165413-221165435 CCAAAAGCGCCTGACTCATATAA No data
Right 946584171 2:221165461-221165483 CTGGTCTTGGGATCTGTGTCTGG No data
946584165_946584171 16 Left 946584165 2:221165422-221165444 CCTGACTCATATAACCAGGCGGG No data
Right 946584171 2:221165461-221165483 CTGGTCTTGGGATCTGTGTCTGG No data
946584167_946584171 2 Left 946584167 2:221165436-221165458 CCAGGCGGGTCAACTTTAGAATT No data
Right 946584171 2:221165461-221165483 CTGGTCTTGGGATCTGTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946584171 Original CRISPR CTGGTCTTGGGATCTGTGTC TGG Intergenic
No off target data available for this crispr