ID: 946585334

View in Genome Browser
Species Human (GRCh38)
Location 2:221180074-221180096
Sequence CCTTATGAGAAGAGGGAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946585330_946585334 -7 Left 946585330 2:221180058-221180080 CCAACATAACTGATGTCCTTATG No data
Right 946585334 2:221180074-221180096 CCTTATGAGAAGAGGGAATCTGG No data
946585327_946585334 26 Left 946585327 2:221180025-221180047 CCTTATTTTAAGGTCATTAAGTT No data
Right 946585334 2:221180074-221180096 CCTTATGAGAAGAGGGAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946585334 Original CRISPR CCTTATGAGAAGAGGGAATC TGG Intergenic
No off target data available for this crispr