ID: 946591285

View in Genome Browser
Species Human (GRCh38)
Location 2:221250834-221250856
Sequence GAGTCCATCAACCTGGAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946591285_946591288 3 Left 946591285 2:221250834-221250856 CCTGTTTCCAGGTTGATGGACTC No data
Right 946591288 2:221250860-221250882 CATGCCCATCAATAGTAGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946591285 Original CRISPR GAGTCCATCAACCTGGAAAC AGG (reversed) Intergenic
No off target data available for this crispr