ID: 946592659

View in Genome Browser
Species Human (GRCh38)
Location 2:221268267-221268289
Sequence TAAGACCCTGAAAATGATCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
946592657_946592659 10 Left 946592657 2:221268234-221268256 CCCAAGGACATTTGGCAAGAGCG No data
Right 946592659 2:221268267-221268289 TAAGACCCTGAAAATGATCCTGG No data
946592658_946592659 9 Left 946592658 2:221268235-221268257 CCAAGGACATTTGGCAAGAGCGA No data
Right 946592659 2:221268267-221268289 TAAGACCCTGAAAATGATCCTGG No data
946592656_946592659 11 Left 946592656 2:221268233-221268255 CCCCAAGGACATTTGGCAAGAGC No data
Right 946592659 2:221268267-221268289 TAAGACCCTGAAAATGATCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
946592659 Original CRISPR TAAGACCCTGAAAATGATCC TGG Intergenic
No off target data available for this crispr